Review



normal goat serum jackson immunoresearch  (Jackson Immuno)


Bioz Verified Symbol Jackson Immuno is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Jackson Immuno normal goat serum jackson immunoresearch
    Normal Goat Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 3712 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/pm41794036-570-112-115
    Average 96 stars, based on 3712 article reviews
    normal goat serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Multiplex sample analysis:

    Article Title: The 40S ribosomal subunit recycling complex modulates mitochondrial dynamics and endoplasmic reticulum - mitochondria tethering at mitochondrial fission/fusion hotspots
    Article Snippet: 10% APS solution Bio-Rad 1610700 TEMED Bio-Rad 1610800 Tris base Sigma-Aldrich 11814273001 Glycine GoldBio G-630-100 Triton X-100 Sigma-Aldrich T8787-100 DMEM, high glucose, GlutaMAX Supplement GIBCO 10566016 Schneider’s Medium GIBCO 21720-024 Percoll Sigma-Aldrich P1644-1L EDTA IBI Scientific IB70182 EGTA BP Biomedicals 195174 Calcium chloride dihydrate Fisher Scientific C79-500 Dimethyl sulfoxide Fisher Scientific BP231-100 2XLaemmli sample buffer Bio-Rad 161-0737 Protease inhibitor cocktail Bimake B14012 Stacking Gel Buffer Bio-Rad 1610799 Resolving Gel Buffer Bio-Rad 1610798 SDS Solution 10% w/v Bio-Rad 1610416 Sodium Azide, 99 % pure ARCOS organics 26628-22-8 MOPS (3-morpholin-4-ylpropane-1-sulfronic acid) GoldBio M-790-1 Apigenin Fisher A1514100MG Sulfaquinoxaline sodium salt Sigma S7382-10G Emetine Sigma-Aldrich 324693 .. Homoharringtonine (HHT) Sigma-Aldrich 50-175-1879 Normal goat serum Jackson ImmunoResearch 005-000-121 2-Aminoethyl diphenylborinate, 98% Thermo fisher 524-95-8 Lipofectamine 3000 Invitrogen L3000015 Lipofectamine RNAi MAX Invitrogen 13778150 RU360 Sigma-Aldrich 557440-500UG BAPTA AM Tocris Bioscience 2787 Puromycin ARCOS organics 227420100 Kanamycin monosulfate GoldBio K-120-5 CCCP Sigma-Aldrich C2759-100MG Cycloheximide Sigma-Aldrich C1988-1G 1M Triethylammonium bicarbonate (TEAB) for TMT experiments Thermo scientific 90114 Protein A/G PLUS-agarose beads Santa Cruz sc-2003 Protein A/G magnetic beads GenScript L00277S Anti-FLAG® M2 Affinity Gel Sigma-Aldrich A2220 ProLong Glass Antifade Mounting medium Invitrogen P36980 PierceTM Anti-c-Myc Magnetic Beads Pierce 88843 Pierce Anti-HA Magnetic Beads Pierce 88836 ATP Bioluminescence Assay Kit HS II Roche 11699709001 Western Lightning Plus-ECL PerkinElmer Inc. NEL104001EA NuPAGE 4-12% Bis-Tris Protein Gels Invitrogen NP0321BOX .. NuPAGE® MOPS SDS running buffers Invitrogen NP0001 NativePAGE 3%–12% Bis-Tris Protein Gels Invitrogen BN1001BOX NativePAGE Running Buffer Kit Invitrogen BN2007 NativePAGE Sample Prep Kit Invitrogen BN2008 JC-10 AdipoGen AGCR13600M001 Rhod-2 Thermo fisher R1244 Duolink® In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich DUO92101-1KT 3X (DYKDDDDK) Peptide APEX Bio A6001 c-Myc tag Peptide APEX Bio A6003 Influenza Hemagglutinin (HA) Peptide APEX Bio A6004 MitoSOXTM Thermo fisher M36008

    Magnetic Beads:

    Article Title: The 40S ribosomal subunit recycling complex modulates mitochondrial dynamics and endoplasmic reticulum - mitochondria tethering at mitochondrial fission/fusion hotspots
    Article Snippet: 10% APS solution Bio-Rad 1610700 TEMED Bio-Rad 1610800 Tris base Sigma-Aldrich 11814273001 Glycine GoldBio G-630-100 Triton X-100 Sigma-Aldrich T8787-100 DMEM, high glucose, GlutaMAX Supplement GIBCO 10566016 Schneider’s Medium GIBCO 21720-024 Percoll Sigma-Aldrich P1644-1L EDTA IBI Scientific IB70182 EGTA BP Biomedicals 195174 Calcium chloride dihydrate Fisher Scientific C79-500 Dimethyl sulfoxide Fisher Scientific BP231-100 2XLaemmli sample buffer Bio-Rad 161-0737 Protease inhibitor cocktail Bimake B14012 Stacking Gel Buffer Bio-Rad 1610799 Resolving Gel Buffer Bio-Rad 1610798 SDS Solution 10% w/v Bio-Rad 1610416 Sodium Azide, 99 % pure ARCOS organics 26628-22-8 MOPS (3-morpholin-4-ylpropane-1-sulfronic acid) GoldBio M-790-1 Apigenin Fisher A1514100MG Sulfaquinoxaline sodium salt Sigma S7382-10G Emetine Sigma-Aldrich 324693 .. Homoharringtonine (HHT) Sigma-Aldrich 50-175-1879 Normal goat serum Jackson ImmunoResearch 005-000-121 2-Aminoethyl diphenylborinate, 98% Thermo fisher 524-95-8 Lipofectamine 3000 Invitrogen L3000015 Lipofectamine RNAi MAX Invitrogen 13778150 RU360 Sigma-Aldrich 557440-500UG BAPTA AM Tocris Bioscience 2787 Puromycin ARCOS organics 227420100 Kanamycin monosulfate GoldBio K-120-5 CCCP Sigma-Aldrich C2759-100MG Cycloheximide Sigma-Aldrich C1988-1G 1M Triethylammonium bicarbonate (TEAB) for TMT experiments Thermo scientific 90114 Protein A/G PLUS-agarose beads Santa Cruz sc-2003 Protein A/G magnetic beads GenScript L00277S Anti-FLAG® M2 Affinity Gel Sigma-Aldrich A2220 ProLong Glass Antifade Mounting medium Invitrogen P36980 PierceTM Anti-c-Myc Magnetic Beads Pierce 88843 Pierce Anti-HA Magnetic Beads Pierce 88836 ATP Bioluminescence Assay Kit HS II Roche 11699709001 Western Lightning Plus-ECL PerkinElmer Inc. NEL104001EA NuPAGE 4-12% Bis-Tris Protein Gels Invitrogen NP0321BOX .. NuPAGE® MOPS SDS running buffers Invitrogen NP0001 NativePAGE 3%–12% Bis-Tris Protein Gels Invitrogen BN1001BOX NativePAGE Running Buffer Kit Invitrogen BN2007 NativePAGE Sample Prep Kit Invitrogen BN2008 JC-10 AdipoGen AGCR13600M001 Rhod-2 Thermo fisher R1244 Duolink® In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich DUO92101-1KT 3X (DYKDDDDK) Peptide APEX Bio A6001 c-Myc tag Peptide APEX Bio A6003 Influenza Hemagglutinin (HA) Peptide APEX Bio A6004 MitoSOXTM Thermo fisher M36008

    ATP Bioluminescent Assay:

    Article Title: The 40S ribosomal subunit recycling complex modulates mitochondrial dynamics and endoplasmic reticulum - mitochondria tethering at mitochondrial fission/fusion hotspots
    Article Snippet: 10% APS solution Bio-Rad 1610700 TEMED Bio-Rad 1610800 Tris base Sigma-Aldrich 11814273001 Glycine GoldBio G-630-100 Triton X-100 Sigma-Aldrich T8787-100 DMEM, high glucose, GlutaMAX Supplement GIBCO 10566016 Schneider’s Medium GIBCO 21720-024 Percoll Sigma-Aldrich P1644-1L EDTA IBI Scientific IB70182 EGTA BP Biomedicals 195174 Calcium chloride dihydrate Fisher Scientific C79-500 Dimethyl sulfoxide Fisher Scientific BP231-100 2XLaemmli sample buffer Bio-Rad 161-0737 Protease inhibitor cocktail Bimake B14012 Stacking Gel Buffer Bio-Rad 1610799 Resolving Gel Buffer Bio-Rad 1610798 SDS Solution 10% w/v Bio-Rad 1610416 Sodium Azide, 99 % pure ARCOS organics 26628-22-8 MOPS (3-morpholin-4-ylpropane-1-sulfronic acid) GoldBio M-790-1 Apigenin Fisher A1514100MG Sulfaquinoxaline sodium salt Sigma S7382-10G Emetine Sigma-Aldrich 324693 .. Homoharringtonine (HHT) Sigma-Aldrich 50-175-1879 Normal goat serum Jackson ImmunoResearch 005-000-121 2-Aminoethyl diphenylborinate, 98% Thermo fisher 524-95-8 Lipofectamine 3000 Invitrogen L3000015 Lipofectamine RNAi MAX Invitrogen 13778150 RU360 Sigma-Aldrich 557440-500UG BAPTA AM Tocris Bioscience 2787 Puromycin ARCOS organics 227420100 Kanamycin monosulfate GoldBio K-120-5 CCCP Sigma-Aldrich C2759-100MG Cycloheximide Sigma-Aldrich C1988-1G 1M Triethylammonium bicarbonate (TEAB) for TMT experiments Thermo scientific 90114 Protein A/G PLUS-agarose beads Santa Cruz sc-2003 Protein A/G magnetic beads GenScript L00277S Anti-FLAG® M2 Affinity Gel Sigma-Aldrich A2220 ProLong Glass Antifade Mounting medium Invitrogen P36980 PierceTM Anti-c-Myc Magnetic Beads Pierce 88843 Pierce Anti-HA Magnetic Beads Pierce 88836 ATP Bioluminescence Assay Kit HS II Roche 11699709001 Western Lightning Plus-ECL PerkinElmer Inc. NEL104001EA NuPAGE 4-12% Bis-Tris Protein Gels Invitrogen NP0321BOX .. NuPAGE® MOPS SDS running buffers Invitrogen NP0001 NativePAGE 3%–12% Bis-Tris Protein Gels Invitrogen BN1001BOX NativePAGE Running Buffer Kit Invitrogen BN2007 NativePAGE Sample Prep Kit Invitrogen BN2008 JC-10 AdipoGen AGCR13600M001 Rhod-2 Thermo fisher R1244 Duolink® In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich DUO92101-1KT 3X (DYKDDDDK) Peptide APEX Bio A6001 c-Myc tag Peptide APEX Bio A6003 Influenza Hemagglutinin (HA) Peptide APEX Bio A6004 MitoSOXTM Thermo fisher M36008

    Western Blot:

    Article Title: The 40S ribosomal subunit recycling complex modulates mitochondrial dynamics and endoplasmic reticulum - mitochondria tethering at mitochondrial fission/fusion hotspots
    Article Snippet: 10% APS solution Bio-Rad 1610700 TEMED Bio-Rad 1610800 Tris base Sigma-Aldrich 11814273001 Glycine GoldBio G-630-100 Triton X-100 Sigma-Aldrich T8787-100 DMEM, high glucose, GlutaMAX Supplement GIBCO 10566016 Schneider’s Medium GIBCO 21720-024 Percoll Sigma-Aldrich P1644-1L EDTA IBI Scientific IB70182 EGTA BP Biomedicals 195174 Calcium chloride dihydrate Fisher Scientific C79-500 Dimethyl sulfoxide Fisher Scientific BP231-100 2XLaemmli sample buffer Bio-Rad 161-0737 Protease inhibitor cocktail Bimake B14012 Stacking Gel Buffer Bio-Rad 1610799 Resolving Gel Buffer Bio-Rad 1610798 SDS Solution 10% w/v Bio-Rad 1610416 Sodium Azide, 99 % pure ARCOS organics 26628-22-8 MOPS (3-morpholin-4-ylpropane-1-sulfronic acid) GoldBio M-790-1 Apigenin Fisher A1514100MG Sulfaquinoxaline sodium salt Sigma S7382-10G Emetine Sigma-Aldrich 324693 .. Homoharringtonine (HHT) Sigma-Aldrich 50-175-1879 Normal goat serum Jackson ImmunoResearch 005-000-121 2-Aminoethyl diphenylborinate, 98% Thermo fisher 524-95-8 Lipofectamine 3000 Invitrogen L3000015 Lipofectamine RNAi MAX Invitrogen 13778150 RU360 Sigma-Aldrich 557440-500UG BAPTA AM Tocris Bioscience 2787 Puromycin ARCOS organics 227420100 Kanamycin monosulfate GoldBio K-120-5 CCCP Sigma-Aldrich C2759-100MG Cycloheximide Sigma-Aldrich C1988-1G 1M Triethylammonium bicarbonate (TEAB) for TMT experiments Thermo scientific 90114 Protein A/G PLUS-agarose beads Santa Cruz sc-2003 Protein A/G magnetic beads GenScript L00277S Anti-FLAG® M2 Affinity Gel Sigma-Aldrich A2220 ProLong Glass Antifade Mounting medium Invitrogen P36980 PierceTM Anti-c-Myc Magnetic Beads Pierce 88843 Pierce Anti-HA Magnetic Beads Pierce 88836 ATP Bioluminescence Assay Kit HS II Roche 11699709001 Western Lightning Plus-ECL PerkinElmer Inc. NEL104001EA NuPAGE 4-12% Bis-Tris Protein Gels Invitrogen NP0321BOX .. NuPAGE® MOPS SDS running buffers Invitrogen NP0001 NativePAGE 3%–12% Bis-Tris Protein Gels Invitrogen BN1001BOX NativePAGE Running Buffer Kit Invitrogen BN2007 NativePAGE Sample Prep Kit Invitrogen BN2008 JC-10 AdipoGen AGCR13600M001 Rhod-2 Thermo fisher R1244 Duolink® In Situ Red Starter Kit Mouse/Rabbit Sigma-Aldrich DUO92101-1KT 3X (DYKDDDDK) Peptide APEX Bio A6001 c-Myc tag Peptide APEX Bio A6003 Influenza Hemagglutinin (HA) Peptide APEX Bio A6004 MitoSOXTM Thermo fisher M36008

    Virus:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Article Title: The gut-brain axis mechanism of normal appetite induced by kynurenic acid.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-c-Fos CST Cat#2250; RRID:AB_2247211 Rabbit anti-p-ERK1/2 CST Cat# 9101; RRID:AB_331646 AF488-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-545-003; RRID:AB_2338046 Cy3-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-165-045; RRID:AB_2338003 Rabbit anti-GPR35 Novus Biologicals Cat# NBP2-24640 Chemicals, peptides, and recombinant proteins KYNA Sigma Cat# K3375-5G CNO Sigma Cat# C0832 Sodium hydroxide Sigma Cat# SLCN2610 Acetonitrile Zhonghui Chemical Cat# 101.4020.43 Fluo-8 AM Abcam Cat# ab142773 Sodium acetate trihydrate Macklin Cat# C15158861 4-OHT Sigma Cat# H6278 Nerve growth factor Sigma Cat# N0513 L-15 medium Gibco Cat# 11415114 Collagenase Gibco Cat# 17101015 Trypsin Gibco Cat# 25200056 Normal goat serum Jackson ImmunoResearch Cat# 005-000-121 Isoflurane RWD Cat# R510-22-10 Bacterial and virus strains CTB555 Brain VTA N/A AAV9-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAVPHPeB-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAV2/2 Retro plus-hsyn-Cre-WPRE-pA Brain VTA N/A AAV9-hSyn-DIO-hM4D(Gi)-mCherry Brain VTA N/A AAV2/9-hsyn-Cre-WPRE-PA Brain VTA N/A AAV2-retro-CMV-DIO-EGFP-shRNA(GPR35)-WPRE-ployA Taitool N/A AAV2-retro-CMV-DIO-EGFP-shRNA(Scramble)-WPRE-ployA Taitool N/A AAV-cfos-creERT2-WPRE-hGH polyA Brain VTA N/A AAV-CAG-Flex-tdTomato Addgene N/A AAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPRE-hGH polyA Brain VTA N/A AAV2/1-Ef1α-DIO-FLP-WPRE-hGH pA Brain VTA N/A H129ΔTK-CAG-LSL-tdT Brain Case N/A AAV2/9-DIO-TK Brain Case N/A AAV2/9-DIO-TVA-mRuby Brain VTA N/A AAV2/9-DIO-RVG Brain VTA N/A RV-EnVA-ΔG-EGFP Brain VTA N/A Experimental models Mouse: C57BL/6J Bestest N/A Mouse: NPY-GFP Jackson Laboratory RRID:IMSR_JAX:008321 Mouse: AgRP-Cre Jackson Laboratory RRID:IMSR_JAX:012899 (Continued on next page) 14 Cell Reports 44, 115659, May 27, 2025 ..

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Recombinant:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Article Title: The gut-brain axis mechanism of normal appetite induced by kynurenic acid.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-c-Fos CST Cat#2250; RRID:AB_2247211 Rabbit anti-p-ERK1/2 CST Cat# 9101; RRID:AB_331646 AF488-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-545-003; RRID:AB_2338046 Cy3-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-165-045; RRID:AB_2338003 Rabbit anti-GPR35 Novus Biologicals Cat# NBP2-24640 Chemicals, peptides, and recombinant proteins KYNA Sigma Cat# K3375-5G CNO Sigma Cat# C0832 Sodium hydroxide Sigma Cat# SLCN2610 Acetonitrile Zhonghui Chemical Cat# 101.4020.43 Fluo-8 AM Abcam Cat# ab142773 Sodium acetate trihydrate Macklin Cat# C15158861 4-OHT Sigma Cat# H6278 Nerve growth factor Sigma Cat# N0513 L-15 medium Gibco Cat# 11415114 Collagenase Gibco Cat# 17101015 Trypsin Gibco Cat# 25200056 Normal goat serum Jackson ImmunoResearch Cat# 005-000-121 Isoflurane RWD Cat# R510-22-10 Bacterial and virus strains CTB555 Brain VTA N/A AAV9-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAVPHPeB-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAV2/2 Retro plus-hsyn-Cre-WPRE-pA Brain VTA N/A AAV9-hSyn-DIO-hM4D(Gi)-mCherry Brain VTA N/A AAV2/9-hsyn-Cre-WPRE-PA Brain VTA N/A AAV2-retro-CMV-DIO-EGFP-shRNA(GPR35)-WPRE-ployA Taitool N/A AAV2-retro-CMV-DIO-EGFP-shRNA(Scramble)-WPRE-ployA Taitool N/A AAV-cfos-creERT2-WPRE-hGH polyA Brain VTA N/A AAV-CAG-Flex-tdTomato Addgene N/A AAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPRE-hGH polyA Brain VTA N/A AAV2/1-Ef1α-DIO-FLP-WPRE-hGH pA Brain VTA N/A H129ΔTK-CAG-LSL-tdT Brain Case N/A AAV2/9-DIO-TK Brain Case N/A AAV2/9-DIO-TVA-mRuby Brain VTA N/A AAV2/9-DIO-RVG Brain VTA N/A RV-EnVA-ΔG-EGFP Brain VTA N/A Experimental models Mouse: C57BL/6J Bestest N/A Mouse: NPY-GFP Jackson Laboratory RRID:IMSR_JAX:008321 Mouse: AgRP-Cre Jackson Laboratory RRID:IMSR_JAX:012899 (Continued on next page) 14 Cell Reports 44, 115659, May 27, 2025 ..

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    Article Title: PRDM13 is required for specification of PAX2 lineage inhibitory neurons in the developing cerebellum.
    Article Snippet: Shared genetic developmental programs in which specific transcription factors affect similar cell fate decisions in distinct tissues are common.. In the developing dorsal neural tube and cerebellum, PTF1A is essential for specification of GABAergic inhibitory neurons and suppression of alternative glutamatergic excitatory neuronal fates.. Previous studies in the mouse dorsal neural tube identified the transcriptional repressor PRDM13 as a transcriptional target of PTF1A that functions to suppress the alternate cell fates to ensure precision in neuronal cell identity.

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Article Title: Ultrastructural membrane dynamics of mouse and human cortical synapses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dynamin 1xA, rabbit polyclonal antibody Custom-made RRID: AB_3674059 Bassoon, mouse monoclonal antibody Enzo Life Sciences cat#: ADI-VAM-PS003-D; RRID: AB_2038857 FluoTag-X2 anti-PSD95 NanoTag Biotechnologies cat#: N3702-At643-L pan-Dynamin 1/2/3, rabbit polyclonal antibody Synaptic Systems cat#: 115002; RRID: AB_887714 FLAG, mouse monoclonal antibody Sigma-Aldrich cat#: F1804; RRID: AB_262044 Beta-actin, rabbit polyclonal antibody Synaptic Systems cat#: 251003; RRID: AB_11042458 Beta-actin, mouse monoclonal antibody Synaptic Systems cat#: 251011; RRID: AB_2619961 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 594 Invitrogen cat#: A11012 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 647 Invitrogen cat#: A21245 F(ab’)2-Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 488 Invitrogen cat#: A11017 Abberior STAR 460L, goat anti-mouse IgG Abberior cat#: ST460L-1001-500UG Streptavidin, Alexa Fluor 555 Conjugate Invitrogen cat#: S32355 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-32211 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Li-COR cat#: 926-32210 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-68071 Chemicals, peptides, and recombinant proteins Fura-2, AM, cell permeant Invitrogen cat#: F1221 Pluronic F-127 (20% Solution in DMSO) Invitrogen cat#: P3000MP Papain Worthington Biochemical cat#: LS003119 DNase Millipore Sigma cat#: DN25 Poly-L-lysine Sigma-Aldrich cat#: P2636 Poly-D-lysine Sigma-Aldrich cat#: P6407 Rat tail collagen I ThermoFisher cat#: A1048301 Trypsin ThermoFisher cat#: 25300054 5-Fluoro-2 ′ -deoxyuridine Sigma-Aldrich cat#: F0503 Uridine Sigma-Aldrich cat#: U3003 NBQX Tocris cat#: 1044 Bicuculline Tocris cat#: 0109 Cationized ferritin from horse spleen Sigma-Aldrich cat#: F7879 Polyvinylpyrrolidone Millipore Sigma cat#: P2307 Paraformaldehyde Electron Microscopy Sciences cat#: 15714 Normal Goat Serum Jackson ImmunoResearch cat#: 005-000-121 KOD Hot Start DNA Polymerase Millipore Sigma cat#: 71086-3 ProLong Diamond Antifade Mountant Invitrogen cat#: P36970 In-Fusion HD cloning kit TAKARA cat#: NC1454739 RIPA buffer Cell Signaling Technology cat#: 9806 cOmplete Mini Protease Inhibitor Roche cat#: 04693159001 Immobilon-FL membranes Millipore Sigma cat#: IPFL00010 Human Brain Whole Tissue Lysate (Adult Whole Normal) Novus Biologicals cat#: NB820-59177 Araldite 502 Ted Pella cat#: 18060 (Continued on next page) Neuron 114, 1–14.e1–e8, February 4, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Eponate 12 Resin Ted Pella cat#: 18005 Dodecenyl Succinic Anhydride (DDSA) Ted Pella cat#: 18022 BDMA, Benzyldimethylamine Ted Pella cat#: 18241 Anhydrous 10% glutaraldehyde in acetone Electron Microscopy Sciences cat#: 16530 Tannic acid Sigma-Aldrich cat#: 403040 Experimental models: Organisms/strains Mouse: C57/BL6J In-house breeding Leipzig University Mouse: C57BL/6NTac Taconic Biosciences B6NTAC Mouse: Dnm1 KO Ferguson et al. 58 Dr. Pietro De Camilli Recombinant DNA Plasmid: f(syn)NLS-RFP-P2A-Dyn1xA Imoto et al. 33 N/A Plasmid: f(syn)NLS-RFP-P2A-Dyn1xB Imoto et al. 33 N/A Lentivirus helper plasmid: pHR-CMV8.2 deltaR Stewart et al., 2003 59 Addgene #8454 Lentivirus helper plasmid: pCMV-VSVG Stewart et al., 2003 59 Addgene #8455 Oligonucleotides Primer, common forward to build Dyn1xA/B-FLAG constructs: caaggacCACGACA TCGACTACAAGGACGACGACGACAAG TAA GCGCCTTCGAATTAATTAAGGC Imoto et al. 33 N/A Primer, reverse to build Dyn1xA-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTTG TAGTC GAGGTCGAAGGGGGGCC Imoto et al. 33 N/A Primer, reverse to build Dyn1xB-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTT GTAGTC GGGGTCACTGATAGTGATTCTGGG Imoto et al. 33 N/A Software and algorithms SynapsEM Watanabe et al. 57 https://github.com/shigekiwatanabe/SynapsEM STED deconvolution, segmentation and analysis Imoto et al. 32 https://github.com/imotolab-neuroem/STED_ image_analysis_package_public_v1.4 Python 3.13.5 Python Software Foundation https://www.python.org Visual Code Studio Microsoft https://code.visualstudio.com Jupyter Project Jupyter https://jupyter.org/ ilastik 1.4.0 ilastik https://www.ilastik.org/ GitHub Copilot GitHub https://github.com/features/copilot Claude Sonnet 4.0 Anthropic https://www.anthropic.com/claude/sonnet ImageJ-Fiji Schindelin et al., 2012 60 https://imagej.net/Fiji TrakEM2 Cardona et al. 61 https://github.com/trakem2 Adobe Illustrator 2021 Adobe https://www.adobe.com/ Adobe Photoshop 2021 Adobe https://www.adobe.com/ Prism GraphPad (Prism 8) https://www.graphpad.com Excel Microsoft https://products.office.com/en-us/explore- office-for-home MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Other Vibratome Leica Biosystems cat#: VT1200S Cryostat Leica Biosystems cat#: CM 3050S Sapphire disks, 6-mm Technotrade cat#: 616-100 Precision coverslips, 18mm dia.

    Membrane:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Electron Microscopy:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Article Title: PRDM13 is required for specification of PAX2 lineage inhibitory neurons in the developing cerebellum.
    Article Snippet: Shared genetic developmental programs in which specific transcription factors affect similar cell fate decisions in distinct tissues are common.. In the developing dorsal neural tube and cerebellum, PTF1A is essential for specification of GABAergic inhibitory neurons and suppression of alternative glutamatergic excitatory neuronal fates.. Previous studies in the mouse dorsal neural tube identified the transcriptional repressor PRDM13 as a transcriptional target of PTF1A that functions to suppress the alternate cell fates to ensure precision in neuronal cell identity.

    Article Title: Ultrastructural membrane dynamics of mouse and human cortical synapses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dynamin 1xA, rabbit polyclonal antibody Custom-made RRID: AB_3674059 Bassoon, mouse monoclonal antibody Enzo Life Sciences cat#: ADI-VAM-PS003-D; RRID: AB_2038857 FluoTag-X2 anti-PSD95 NanoTag Biotechnologies cat#: N3702-At643-L pan-Dynamin 1/2/3, rabbit polyclonal antibody Synaptic Systems cat#: 115002; RRID: AB_887714 FLAG, mouse monoclonal antibody Sigma-Aldrich cat#: F1804; RRID: AB_262044 Beta-actin, rabbit polyclonal antibody Synaptic Systems cat#: 251003; RRID: AB_11042458 Beta-actin, mouse monoclonal antibody Synaptic Systems cat#: 251011; RRID: AB_2619961 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 594 Invitrogen cat#: A11012 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 647 Invitrogen cat#: A21245 F(ab’)2-Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 488 Invitrogen cat#: A11017 Abberior STAR 460L, goat anti-mouse IgG Abberior cat#: ST460L-1001-500UG Streptavidin, Alexa Fluor 555 Conjugate Invitrogen cat#: S32355 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-32211 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Li-COR cat#: 926-32210 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-68071 Chemicals, peptides, and recombinant proteins Fura-2, AM, cell permeant Invitrogen cat#: F1221 Pluronic F-127 (20% Solution in DMSO) Invitrogen cat#: P3000MP Papain Worthington Biochemical cat#: LS003119 DNase Millipore Sigma cat#: DN25 Poly-L-lysine Sigma-Aldrich cat#: P2636 Poly-D-lysine Sigma-Aldrich cat#: P6407 Rat tail collagen I ThermoFisher cat#: A1048301 Trypsin ThermoFisher cat#: 25300054 5-Fluoro-2 ′ -deoxyuridine Sigma-Aldrich cat#: F0503 Uridine Sigma-Aldrich cat#: U3003 NBQX Tocris cat#: 1044 Bicuculline Tocris cat#: 0109 Cationized ferritin from horse spleen Sigma-Aldrich cat#: F7879 Polyvinylpyrrolidone Millipore Sigma cat#: P2307 Paraformaldehyde Electron Microscopy Sciences cat#: 15714 Normal Goat Serum Jackson ImmunoResearch cat#: 005-000-121 KOD Hot Start DNA Polymerase Millipore Sigma cat#: 71086-3 ProLong Diamond Antifade Mountant Invitrogen cat#: P36970 In-Fusion HD cloning kit TAKARA cat#: NC1454739 RIPA buffer Cell Signaling Technology cat#: 9806 cOmplete Mini Protease Inhibitor Roche cat#: 04693159001 Immobilon-FL membranes Millipore Sigma cat#: IPFL00010 Human Brain Whole Tissue Lysate (Adult Whole Normal) Novus Biologicals cat#: NB820-59177 Araldite 502 Ted Pella cat#: 18060 (Continued on next page) Neuron 114, 1–14.e1–e8, February 4, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Eponate 12 Resin Ted Pella cat#: 18005 Dodecenyl Succinic Anhydride (DDSA) Ted Pella cat#: 18022 BDMA, Benzyldimethylamine Ted Pella cat#: 18241 Anhydrous 10% glutaraldehyde in acetone Electron Microscopy Sciences cat#: 16530 Tannic acid Sigma-Aldrich cat#: 403040 Experimental models: Organisms/strains Mouse: C57/BL6J In-house breeding Leipzig University Mouse: C57BL/6NTac Taconic Biosciences B6NTAC Mouse: Dnm1 KO Ferguson et al. 58 Dr. Pietro De Camilli Recombinant DNA Plasmid: f(syn)NLS-RFP-P2A-Dyn1xA Imoto et al. 33 N/A Plasmid: f(syn)NLS-RFP-P2A-Dyn1xB Imoto et al. 33 N/A Lentivirus helper plasmid: pHR-CMV8.2 deltaR Stewart et al., 2003 59 Addgene #8454 Lentivirus helper plasmid: pCMV-VSVG Stewart et al., 2003 59 Addgene #8455 Oligonucleotides Primer, common forward to build Dyn1xA/B-FLAG constructs: caaggacCACGACA TCGACTACAAGGACGACGACGACAAG TAA GCGCCTTCGAATTAATTAAGGC Imoto et al. 33 N/A Primer, reverse to build Dyn1xA-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTTG TAGTC GAGGTCGAAGGGGGGCC Imoto et al. 33 N/A Primer, reverse to build Dyn1xB-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTT GTAGTC GGGGTCACTGATAGTGATTCTGGG Imoto et al. 33 N/A Software and algorithms SynapsEM Watanabe et al. 57 https://github.com/shigekiwatanabe/SynapsEM STED deconvolution, segmentation and analysis Imoto et al. 32 https://github.com/imotolab-neuroem/STED_ image_analysis_package_public_v1.4 Python 3.13.5 Python Software Foundation https://www.python.org Visual Code Studio Microsoft https://code.visualstudio.com Jupyter Project Jupyter https://jupyter.org/ ilastik 1.4.0 ilastik https://www.ilastik.org/ GitHub Copilot GitHub https://github.com/features/copilot Claude Sonnet 4.0 Anthropic https://www.anthropic.com/claude/sonnet ImageJ-Fiji Schindelin et al., 2012 60 https://imagej.net/Fiji TrakEM2 Cardona et al. 61 https://github.com/trakem2 Adobe Illustrator 2021 Adobe https://www.adobe.com/ Adobe Photoshop 2021 Adobe https://www.adobe.com/ Prism GraphPad (Prism 8) https://www.graphpad.com Excel Microsoft https://products.office.com/en-us/explore- office-for-home MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Other Vibratome Leica Biosystems cat#: VT1200S Cryostat Leica Biosystems cat#: CM 3050S Sapphire disks, 6-mm Technotrade cat#: 616-100 Precision coverslips, 18mm dia.

    Protease Inhibitor:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Article Title: Ultrastructural membrane dynamics of mouse and human cortical synapses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dynamin 1xA, rabbit polyclonal antibody Custom-made RRID: AB_3674059 Bassoon, mouse monoclonal antibody Enzo Life Sciences cat#: ADI-VAM-PS003-D; RRID: AB_2038857 FluoTag-X2 anti-PSD95 NanoTag Biotechnologies cat#: N3702-At643-L pan-Dynamin 1/2/3, rabbit polyclonal antibody Synaptic Systems cat#: 115002; RRID: AB_887714 FLAG, mouse monoclonal antibody Sigma-Aldrich cat#: F1804; RRID: AB_262044 Beta-actin, rabbit polyclonal antibody Synaptic Systems cat#: 251003; RRID: AB_11042458 Beta-actin, mouse monoclonal antibody Synaptic Systems cat#: 251011; RRID: AB_2619961 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 594 Invitrogen cat#: A11012 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 647 Invitrogen cat#: A21245 F(ab’)2-Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 488 Invitrogen cat#: A11017 Abberior STAR 460L, goat anti-mouse IgG Abberior cat#: ST460L-1001-500UG Streptavidin, Alexa Fluor 555 Conjugate Invitrogen cat#: S32355 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-32211 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Li-COR cat#: 926-32210 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-68071 Chemicals, peptides, and recombinant proteins Fura-2, AM, cell permeant Invitrogen cat#: F1221 Pluronic F-127 (20% Solution in DMSO) Invitrogen cat#: P3000MP Papain Worthington Biochemical cat#: LS003119 DNase Millipore Sigma cat#: DN25 Poly-L-lysine Sigma-Aldrich cat#: P2636 Poly-D-lysine Sigma-Aldrich cat#: P6407 Rat tail collagen I ThermoFisher cat#: A1048301 Trypsin ThermoFisher cat#: 25300054 5-Fluoro-2 ′ -deoxyuridine Sigma-Aldrich cat#: F0503 Uridine Sigma-Aldrich cat#: U3003 NBQX Tocris cat#: 1044 Bicuculline Tocris cat#: 0109 Cationized ferritin from horse spleen Sigma-Aldrich cat#: F7879 Polyvinylpyrrolidone Millipore Sigma cat#: P2307 Paraformaldehyde Electron Microscopy Sciences cat#: 15714 Normal Goat Serum Jackson ImmunoResearch cat#: 005-000-121 KOD Hot Start DNA Polymerase Millipore Sigma cat#: 71086-3 ProLong Diamond Antifade Mountant Invitrogen cat#: P36970 In-Fusion HD cloning kit TAKARA cat#: NC1454739 RIPA buffer Cell Signaling Technology cat#: 9806 cOmplete Mini Protease Inhibitor Roche cat#: 04693159001 Immobilon-FL membranes Millipore Sigma cat#: IPFL00010 Human Brain Whole Tissue Lysate (Adult Whole Normal) Novus Biologicals cat#: NB820-59177 Araldite 502 Ted Pella cat#: 18060 (Continued on next page) Neuron 114, 1–14.e1–e8, February 4, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Eponate 12 Resin Ted Pella cat#: 18005 Dodecenyl Succinic Anhydride (DDSA) Ted Pella cat#: 18022 BDMA, Benzyldimethylamine Ted Pella cat#: 18241 Anhydrous 10% glutaraldehyde in acetone Electron Microscopy Sciences cat#: 16530 Tannic acid Sigma-Aldrich cat#: 403040 Experimental models: Organisms/strains Mouse: C57/BL6J In-house breeding Leipzig University Mouse: C57BL/6NTac Taconic Biosciences B6NTAC Mouse: Dnm1 KO Ferguson et al. 58 Dr. Pietro De Camilli Recombinant DNA Plasmid: f(syn)NLS-RFP-P2A-Dyn1xA Imoto et al. 33 N/A Plasmid: f(syn)NLS-RFP-P2A-Dyn1xB Imoto et al. 33 N/A Lentivirus helper plasmid: pHR-CMV8.2 deltaR Stewart et al., 2003 59 Addgene #8454 Lentivirus helper plasmid: pCMV-VSVG Stewart et al., 2003 59 Addgene #8455 Oligonucleotides Primer, common forward to build Dyn1xA/B-FLAG constructs: caaggacCACGACA TCGACTACAAGGACGACGACGACAAG TAA GCGCCTTCGAATTAATTAAGGC Imoto et al. 33 N/A Primer, reverse to build Dyn1xA-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTTG TAGTC GAGGTCGAAGGGGGGCC Imoto et al. 33 N/A Primer, reverse to build Dyn1xB-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTT GTAGTC GGGGTCACTGATAGTGATTCTGGG Imoto et al. 33 N/A Software and algorithms SynapsEM Watanabe et al. 57 https://github.com/shigekiwatanabe/SynapsEM STED deconvolution, segmentation and analysis Imoto et al. 32 https://github.com/imotolab-neuroem/STED_ image_analysis_package_public_v1.4 Python 3.13.5 Python Software Foundation https://www.python.org Visual Code Studio Microsoft https://code.visualstudio.com Jupyter Project Jupyter https://jupyter.org/ ilastik 1.4.0 ilastik https://www.ilastik.org/ GitHub Copilot GitHub https://github.com/features/copilot Claude Sonnet 4.0 Anthropic https://www.anthropic.com/claude/sonnet ImageJ-Fiji Schindelin et al., 2012 60 https://imagej.net/Fiji TrakEM2 Cardona et al. 61 https://github.com/trakem2 Adobe Illustrator 2021 Adobe https://www.adobe.com/ Adobe Photoshop 2021 Adobe https://www.adobe.com/ Prism GraphPad (Prism 8) https://www.graphpad.com Excel Microsoft https://products.office.com/en-us/explore- office-for-home MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Other Vibratome Leica Biosystems cat#: VT1200S Cryostat Leica Biosystems cat#: CM 3050S Sapphire disks, 6-mm Technotrade cat#: 616-100 Precision coverslips, 18mm dia.

    BIA-KA:

    Article Title: Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2.
    Article Snippet: Article Cytoplasmic tail diversity determines the effector bias of the adhesion GPCR ADGRL2

    Bioprocessing:

    Article Title: The gut-brain axis mechanism of normal appetite induced by kynurenic acid.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-c-Fos CST Cat#2250; RRID:AB_2247211 Rabbit anti-p-ERK1/2 CST Cat# 9101; RRID:AB_331646 AF488-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-545-003; RRID:AB_2338046 Cy3-Affinipure Goat Anti-Rabbit IgG(H + L) Jackson ImmunoResearch Cat# 111-165-045; RRID:AB_2338003 Rabbit anti-GPR35 Novus Biologicals Cat# NBP2-24640 Chemicals, peptides, and recombinant proteins KYNA Sigma Cat# K3375-5G CNO Sigma Cat# C0832 Sodium hydroxide Sigma Cat# SLCN2610 Acetonitrile Zhonghui Chemical Cat# 101.4020.43 Fluo-8 AM Abcam Cat# ab142773 Sodium acetate trihydrate Macklin Cat# C15158861 4-OHT Sigma Cat# H6278 Nerve growth factor Sigma Cat# N0513 L-15 medium Gibco Cat# 11415114 Collagenase Gibco Cat# 17101015 Trypsin Gibco Cat# 25200056 Normal goat serum Jackson ImmunoResearch Cat# 005-000-121 Isoflurane RWD Cat# R510-22-10 Bacterial and virus strains CTB555 Brain VTA N/A AAV9-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAVPHPeB-hSyn-DIO-hM3D(Gq)-mCherry Brain VTA N/A AAV2/2 Retro plus-hsyn-Cre-WPRE-pA Brain VTA N/A AAV9-hSyn-DIO-hM4D(Gi)-mCherry Brain VTA N/A AAV2/9-hsyn-Cre-WPRE-PA Brain VTA N/A AAV2-retro-CMV-DIO-EGFP-shRNA(GPR35)-WPRE-ployA Taitool N/A AAV2-retro-CMV-DIO-EGFP-shRNA(Scramble)-WPRE-ployA Taitool N/A AAV-cfos-creERT2-WPRE-hGH polyA Brain VTA N/A AAV-CAG-Flex-tdTomato Addgene N/A AAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPRE-hGH polyA Brain VTA N/A AAV2/1-Ef1α-DIO-FLP-WPRE-hGH pA Brain VTA N/A H129ΔTK-CAG-LSL-tdT Brain Case N/A AAV2/9-DIO-TK Brain Case N/A AAV2/9-DIO-TVA-mRuby Brain VTA N/A AAV2/9-DIO-RVG Brain VTA N/A RV-EnVA-ΔG-EGFP Brain VTA N/A Experimental models Mouse: C57BL/6J Bestest N/A Mouse: NPY-GFP Jackson Laboratory RRID:IMSR_JAX:008321 Mouse: AgRP-Cre Jackson Laboratory RRID:IMSR_JAX:012899 (Continued on next page) 14 Cell Reports 44, 115659, May 27, 2025 ..

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Multiplex Assay:

    Article Title: Juvenile-to-adult refinement of thalamic reticular circuits via LRRTM3 enables high-resolution sensory encoding.
    Article Snippet: In brief Contrary to the classical view that sensory circuits stabilize after early critical periods, Lee, Han, et al. demonstrate that the thalamic reticular nucleus (TRN) continues to undergo functionally significant remodeling into adulthood.. This late-stage refinement, mediated by the synaptic adhesion molecule LRRTM3, selectively rebalances corticothalamic inputs to the TRN via distinct extracellular mechanisms.. LRRTM3-dependent circuit maturation is essential for achieving adult-like perceptual precision.

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    Real-time Polymerase Chain Reaction:

    Article Title: Juvenile-to-adult refinement of thalamic reticular circuits via LRRTM3 enables high-resolution sensory encoding.
    Article Snippet: In brief Contrary to the classical view that sensory circuits stabilize after early critical periods, Lee, Han, et al. demonstrate that the thalamic reticular nucleus (TRN) continues to undergo functionally significant remodeling into adulthood.. This late-stage refinement, mediated by the synaptic adhesion molecule LRRTM3, selectively rebalances corticothalamic inputs to the TRN via distinct extracellular mechanisms.. LRRTM3-dependent circuit maturation is essential for achieving adult-like perceptual precision.

    Modification:

    Article Title: Juvenile-to-adult refinement of thalamic reticular circuits via LRRTM3 enables high-resolution sensory encoding.
    Article Snippet: In brief Contrary to the classical view that sensory circuits stabilize after early critical periods, Lee, Han, et al. demonstrate that the thalamic reticular nucleus (TRN) continues to undergo functionally significant remodeling into adulthood.. This late-stage refinement, mediated by the synaptic adhesion molecule LRRTM3, selectively rebalances corticothalamic inputs to the TRN via distinct extracellular mechanisms.. LRRTM3-dependent circuit maturation is essential for achieving adult-like perceptual precision.

    SYBR Green Assay:

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    RNAscope:

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Bi-directional communication between intrinsic enteric neurons and ILC2s inhibits host defense against helminth infection.
    Article Snippet: In brief Recent studies highlight the role of neurons in regulating anti-helminth immune responses, suggesting that intrinsic enteric neurons (iENs) may orchestrate intestinal immunity.. Wang and Zhang et al. show that iENs sense helminth infection-induced ILC2 activation through IL-13 receptors, which in turn constrain anti-helminth immunity.. These findings uncover a bi-directional intrinsic enteric neuroimmune crosstalk that influences pathogen clearance.

    Purification:

    Article Title: PRDM13 is required for specification of PAX2 lineage inhibitory neurons in the developing cerebellum.
    Article Snippet: Shared genetic developmental programs in which specific transcription factors affect similar cell fate decisions in distinct tissues are common.. In the developing dorsal neural tube and cerebellum, PTF1A is essential for specification of GABAergic inhibitory neurons and suppression of alternative glutamatergic excitatory neuronal fates.. Previous studies in the mouse dorsal neural tube identified the transcriptional repressor PRDM13 as a transcriptional target of PTF1A that functions to suppress the alternate cell fates to ensure precision in neuronal cell identity.

    Plasmid Preparation:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Control:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Clinical Proteomics:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Cloning:

    Article Title: Ultrastructural membrane dynamics of mouse and human cortical synapses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dynamin 1xA, rabbit polyclonal antibody Custom-made RRID: AB_3674059 Bassoon, mouse monoclonal antibody Enzo Life Sciences cat#: ADI-VAM-PS003-D; RRID: AB_2038857 FluoTag-X2 anti-PSD95 NanoTag Biotechnologies cat#: N3702-At643-L pan-Dynamin 1/2/3, rabbit polyclonal antibody Synaptic Systems cat#: 115002; RRID: AB_887714 FLAG, mouse monoclonal antibody Sigma-Aldrich cat#: F1804; RRID: AB_262044 Beta-actin, rabbit polyclonal antibody Synaptic Systems cat#: 251003; RRID: AB_11042458 Beta-actin, mouse monoclonal antibody Synaptic Systems cat#: 251011; RRID: AB_2619961 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 594 Invitrogen cat#: A11012 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 647 Invitrogen cat#: A21245 F(ab’)2-Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa 488 Invitrogen cat#: A11017 Abberior STAR 460L, goat anti-mouse IgG Abberior cat#: ST460L-1001-500UG Streptavidin, Alexa Fluor 555 Conjugate Invitrogen cat#: S32355 IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-32211 IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Li-COR cat#: 926-32210 IRDye 680RD Goat anti-Rabbit IgG Secondary Antibody Li-COR cat#: 926-68071 Chemicals, peptides, and recombinant proteins Fura-2, AM, cell permeant Invitrogen cat#: F1221 Pluronic F-127 (20% Solution in DMSO) Invitrogen cat#: P3000MP Papain Worthington Biochemical cat#: LS003119 DNase Millipore Sigma cat#: DN25 Poly-L-lysine Sigma-Aldrich cat#: P2636 Poly-D-lysine Sigma-Aldrich cat#: P6407 Rat tail collagen I ThermoFisher cat#: A1048301 Trypsin ThermoFisher cat#: 25300054 5-Fluoro-2 ′ -deoxyuridine Sigma-Aldrich cat#: F0503 Uridine Sigma-Aldrich cat#: U3003 NBQX Tocris cat#: 1044 Bicuculline Tocris cat#: 0109 Cationized ferritin from horse spleen Sigma-Aldrich cat#: F7879 Polyvinylpyrrolidone Millipore Sigma cat#: P2307 Paraformaldehyde Electron Microscopy Sciences cat#: 15714 Normal Goat Serum Jackson ImmunoResearch cat#: 005-000-121 KOD Hot Start DNA Polymerase Millipore Sigma cat#: 71086-3 ProLong Diamond Antifade Mountant Invitrogen cat#: P36970 In-Fusion HD cloning kit TAKARA cat#: NC1454739 RIPA buffer Cell Signaling Technology cat#: 9806 cOmplete Mini Protease Inhibitor Roche cat#: 04693159001 Immobilon-FL membranes Millipore Sigma cat#: IPFL00010 Human Brain Whole Tissue Lysate (Adult Whole Normal) Novus Biologicals cat#: NB820-59177 Araldite 502 Ted Pella cat#: 18060 (Continued on next page) Neuron 114, 1–14.e1–e8, February 4, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Eponate 12 Resin Ted Pella cat#: 18005 Dodecenyl Succinic Anhydride (DDSA) Ted Pella cat#: 18022 BDMA, Benzyldimethylamine Ted Pella cat#: 18241 Anhydrous 10% glutaraldehyde in acetone Electron Microscopy Sciences cat#: 16530 Tannic acid Sigma-Aldrich cat#: 403040 Experimental models: Organisms/strains Mouse: C57/BL6J In-house breeding Leipzig University Mouse: C57BL/6NTac Taconic Biosciences B6NTAC Mouse: Dnm1 KO Ferguson et al. 58 Dr. Pietro De Camilli Recombinant DNA Plasmid: f(syn)NLS-RFP-P2A-Dyn1xA Imoto et al. 33 N/A Plasmid: f(syn)NLS-RFP-P2A-Dyn1xB Imoto et al. 33 N/A Lentivirus helper plasmid: pHR-CMV8.2 deltaR Stewart et al., 2003 59 Addgene #8454 Lentivirus helper plasmid: pCMV-VSVG Stewart et al., 2003 59 Addgene #8455 Oligonucleotides Primer, common forward to build Dyn1xA/B-FLAG constructs: caaggacCACGACA TCGACTACAAGGACGACGACGACAAG TAA GCGCCTTCGAATTAATTAAGGC Imoto et al. 33 N/A Primer, reverse to build Dyn1xA-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTTG TAGTC GAGGTCGAAGGGGGGCC Imoto et al. 33 N/A Primer, reverse to build Dyn1xB-FLAG construct: atgtcgtgGTCCTTGTAGTCACCGTCGTGGTCCTT GTAGTC GGGGTCACTGATAGTGATTCTGGG Imoto et al. 33 N/A Software and algorithms SynapsEM Watanabe et al. 57 https://github.com/shigekiwatanabe/SynapsEM STED deconvolution, segmentation and analysis Imoto et al. 32 https://github.com/imotolab-neuroem/STED_ image_analysis_package_public_v1.4 Python 3.13.5 Python Software Foundation https://www.python.org Visual Code Studio Microsoft https://code.visualstudio.com Jupyter Project Jupyter https://jupyter.org/ ilastik 1.4.0 ilastik https://www.ilastik.org/ GitHub Copilot GitHub https://github.com/features/copilot Claude Sonnet 4.0 Anthropic https://www.anthropic.com/claude/sonnet ImageJ-Fiji Schindelin et al., 2012 60 https://imagej.net/Fiji TrakEM2 Cardona et al. 61 https://github.com/trakem2 Adobe Illustrator 2021 Adobe https://www.adobe.com/ Adobe Photoshop 2021 Adobe https://www.adobe.com/ Prism GraphPad (Prism 8) https://www.graphpad.com Excel Microsoft https://products.office.com/en-us/explore- office-for-home MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Other Vibratome Leica Biosystems cat#: VT1200S Cryostat Leica Biosystems cat#: CM 3050S Sapphire disks, 6-mm Technotrade cat#: 616-100 Precision coverslips, 18mm dia.



    Similar Products

    96
    Jackson Immuno normal goat serum jackson immunoresearch
    Normal Goat Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/pm41794036-570-112-115
    Average 96 stars, based on 1 article reviews
    normal goat serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Jackson Immuno v v normal goat serum jackson immunoresearch
    V V Normal Goat Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/pmc12962106-92-33-37
    Average 96 stars, based on 1 article reviews
    v v normal goat serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Jackson Immuno h3570 normal goat serum jackson immunoresearch
    H3570 Normal Goat Serum Jackson Immunoresearch, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/pm41671085-901-177-181
    Average 96 stars, based on 1 article reviews
    h3570 normal goat serum jackson immunoresearch - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Jackson Immuno jackson immunoresearch code 005 000 121
    Jackson Immunoresearch Code 005 000 121, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/us12527840-607-22-22
    Average 96 stars, based on 1 article reviews
    jackson immunoresearch code 005 000 121 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Jackson Immuno v v goat serum catalog no 005 000 001 jackson immunoresearch laboratories
    V V Goat Serum Catalog No 005 000 001 Jackson Immunoresearch Laboratories, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/Normal+Goat+Serum/pmc12775946-272-31-37
    Average 96 stars, based on 1 article reviews
    v v goat serum catalog no 005 000 001 jackson immunoresearch laboratories - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Jackson Immuno normal mouse serum jackson immunoresearch jackson immunoresearch labs
    Normal Mouse Serum Jackson Immunoresearch Jackson Immunoresearch Labs, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/normal+goat+serum+jackson+immunoresearch/AffiniPure+Fab+Fragment+Goat+Anti-Mouse+IgG/pm41448185-780-29-32
    Average 96 stars, based on 1 article reviews
    normal mouse serum jackson immunoresearch jackson immunoresearch labs - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results